86
|
Thermo Fisher
sc r ip t c 8716062 10 Sc R Ip T C 8716062 10, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/sc r ip t c 8716062 10/product/Thermo Fisher Average 86 stars, based on 1 article reviews
sc r ip t c 8716062 10 - by Bioz Stars,
2026-04
86/100 stars
|
Buy from Supplier |
90
|
Promega
dual- ac c ep te d m an u sc r ip t luciferase reporter assay system Dual Ac C Ep Te D M An U Sc R Ip T Luciferase Reporter Assay System, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/dual- ac c ep te d m an u sc r ip t luciferase reporter assay system/product/Promega Average 90 stars, based on 1 article reviews
dual- ac c ep te d m an u sc r ip t luciferase reporter assay system - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
STAB VIDA
cyclophilin a reverse primer- ac c ep te d m an u sc r ip t 5’gcccgcaagtcaaagaaattagag3’ Cyclophilin A Reverse Primer Ac C Ep Te D M An U Sc R Ip T 5’gcccgcaagtcaaagaaattagag3’, supplied by STAB VIDA, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/cyclophilin a reverse primer- ac c ep te d m an u sc r ip t 5’gcccgcaagtcaaagaaattagag3’/product/STAB VIDA Average 90 stars, based on 1 article reviews
cyclophilin a reverse primer- ac c ep te d m an u sc r ip t 5’gcccgcaagtcaaagaaattagag3’ - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Illumina Inc
ac cep te m a scr ipt 5 Ac Cep Te M A Scr Ipt 5, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/ac cep te m a scr ipt 5/product/Illumina Inc Average 90 stars, based on 1 article reviews
ac cep te m a scr ipt 5 - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
99
|
Bruker Corporation
sc r ip t 9 bruker nano dimension icon Sc R Ip T 9 Bruker Nano Dimension Icon, supplied by Bruker Corporation, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/sc r ip t 9 bruker nano dimension icon/product/Bruker Corporation Average 99 stars, based on 1 article reviews
sc r ip t 9 bruker nano dimension icon - by Bioz Stars,
2026-04
99/100 stars
|
Buy from Supplier |
86
|
Thermo Fisher
sc r ip t hs00300268 Sc R Ip T Hs00300268, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/sc r ip t hs00300268/product/Thermo Fisher Average 86 stars, based on 1 article reviews
sc r ip t hs00300268 - by Bioz Stars,
2026-04
86/100 stars
|
Buy from Supplier |
90
|
Merck & Co
amz30 Amz30, supplied by Merck & Co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/amz30/product/Merck & Co Average 90 stars, based on 1 article reviews
amz30 - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
National Research Council Canada
membrane bioreactor Membrane Bioreactor, supplied by National Research Council Canada, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/membrane bioreactor/product/National Research Council Canada Average 90 stars, based on 1 article reviews
membrane bioreactor - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Hitachi Ltd
h-8100 H 8100, supplied by Hitachi Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/h-8100/product/Hitachi Ltd Average 90 stars, based on 1 article reviews
h-8100 - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Merck & Co
nuvaring Nuvaring, supplied by Merck & Co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/nuvaring/product/Merck & Co Average 90 stars, based on 1 article reviews
nuvaring - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
Bruker Corporation
ultrahigh-resolution hybrid quadrupole/time-of-ac c ep te d m an u sc r ip t flight mass spectrometer (uhr-q-tof–ms/ms Ultrahigh Resolution Hybrid Quadrupole/Time Of Ac C Ep Te D M An U Sc R Ip T Flight Mass Spectrometer (Uhr Q Tof–Ms/Ms, supplied by Bruker Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/ultrahigh-resolution hybrid quadrupole/time-of-ac c ep te d m an u sc r ip t flight mass spectrometer (uhr-q-tof–ms/ms/product/Bruker Corporation Average 90 stars, based on 1 article reviews
ultrahigh-resolution hybrid quadrupole/time-of-ac c ep te d m an u sc r ip t flight mass spectrometer (uhr-q-tof–ms/ms - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |
90
|
National Research Council Canada
human cells Human Cells, supplied by National Research Council Canada, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/human cells/product/National Research Council Canada Average 90 stars, based on 1 article reviews
human cells - by Bioz Stars,
2026-04
90/100 stars
|
Buy from Supplier |