sc r ip t system Search Results


86
Thermo Fisher sc r ip t c 8716062 10
Sc R Ip T C 8716062 10, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sc r ip t c 8716062 10/product/Thermo Fisher
Average 86 stars, based on 1 article reviews
sc r ip t c 8716062 10 - by Bioz Stars, 2026-04
86/100 stars
  Buy from Supplier

90
Promega dual- ac c ep te d m an u sc r ip t luciferase reporter assay system
Dual Ac C Ep Te D M An U Sc R Ip T Luciferase Reporter Assay System, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/dual- ac c ep te d m an u sc r ip t luciferase reporter assay system/product/Promega
Average 90 stars, based on 1 article reviews
dual- ac c ep te d m an u sc r ip t luciferase reporter assay system - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
STAB VIDA cyclophilin a reverse primer- ac c ep te d m an u sc r ip t 5’gcccgcaagtcaaagaaattagag3’
Cyclophilin A Reverse Primer Ac C Ep Te D M An U Sc R Ip T 5’gcccgcaagtcaaagaaattagag3’, supplied by STAB VIDA, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cyclophilin a reverse primer- ac c ep te d m an u sc r ip t 5’gcccgcaagtcaaagaaattagag3’/product/STAB VIDA
Average 90 stars, based on 1 article reviews
cyclophilin a reverse primer- ac c ep te d m an u sc r ip t 5’gcccgcaagtcaaagaaattagag3’ - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Illumina Inc ac cep te m a scr ipt 5
Ac Cep Te M A Scr Ipt 5, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ac cep te m a scr ipt 5/product/Illumina Inc
Average 90 stars, based on 1 article reviews
ac cep te m a scr ipt 5 - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

99
Bruker Corporation sc r ip t 9 bruker nano dimension icon
Sc R Ip T 9 Bruker Nano Dimension Icon, supplied by Bruker Corporation, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sc r ip t 9 bruker nano dimension icon/product/Bruker Corporation
Average 99 stars, based on 1 article reviews
sc r ip t 9 bruker nano dimension icon - by Bioz Stars, 2026-04
99/100 stars
  Buy from Supplier

86
Thermo Fisher sc r ip t hs00300268
Sc R Ip T Hs00300268, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sc r ip t hs00300268/product/Thermo Fisher
Average 86 stars, based on 1 article reviews
sc r ip t hs00300268 - by Bioz Stars, 2026-04
86/100 stars
  Buy from Supplier

90
Merck & Co amz30
Amz30, supplied by Merck & Co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/amz30/product/Merck & Co
Average 90 stars, based on 1 article reviews
amz30 - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
National Research Council Canada membrane bioreactor
Membrane Bioreactor, supplied by National Research Council Canada, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/membrane bioreactor/product/National Research Council Canada
Average 90 stars, based on 1 article reviews
membrane bioreactor - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Hitachi Ltd h-8100
H 8100, supplied by Hitachi Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/h-8100/product/Hitachi Ltd
Average 90 stars, based on 1 article reviews
h-8100 - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Merck & Co nuvaring
Nuvaring, supplied by Merck & Co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/nuvaring/product/Merck & Co
Average 90 stars, based on 1 article reviews
nuvaring - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Bruker Corporation ultrahigh-resolution hybrid quadrupole/time-of-ac c ep te d m an u sc r ip t flight mass spectrometer (uhr-q-tof–ms/ms
Ultrahigh Resolution Hybrid Quadrupole/Time Of Ac C Ep Te D M An U Sc R Ip T Flight Mass Spectrometer (Uhr Q Tof–Ms/Ms, supplied by Bruker Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ultrahigh-resolution hybrid quadrupole/time-of-ac c ep te d m an u sc r ip t flight mass spectrometer (uhr-q-tof–ms/ms/product/Bruker Corporation
Average 90 stars, based on 1 article reviews
ultrahigh-resolution hybrid quadrupole/time-of-ac c ep te d m an u sc r ip t flight mass spectrometer (uhr-q-tof–ms/ms - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
National Research Council Canada human cells
Human Cells, supplied by National Research Council Canada, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/human cells/product/National Research Council Canada
Average 90 stars, based on 1 article reviews
human cells - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

Image Search Results